Here You can find all working primers for plants and bacteria used in our practice 🙂

Name 5′->3′ b.p. Target DNA Reference Comments
BACTERIAL PRIMERS
FD1 agagtttgatcctggctcag 20 16S rRNA (Weisburg et al., 1991) universal
RD1 aaggaggtgatccagcc 17 16S rRNA (Weisburg et al., 1991) universal
BD_F aacttcgtgccagcagc 17 16S rRNA (Korostik et al., 2006) for sequencing of 16S rRNA
BD_R gtcatccccaccttcctc 18 16S rRNA (Korostik et al., 2006) for sequencing of 16S rRNA
FGPL 132 ccgggtttccccattcgg 18 16S-23S rRNA (Navarro et al., 1992) universal
FGPS 1490-72 tgcggctggatcccctcctt 20 16S-23S rRNA (Ponsonnet and Nesme, 1994) universal
ITSR cgcagcgtatcacgtccttc 20 ITS (Zotov et al., 2013) alternative to FGPL 132 primer for Rhizobium spp.
ITSR2 gcgttcgctcgccactac 18 ITS (Zotov et al., 2013) alternative to FGPL 132 primer for Rhizobium spp.
Ile-F aagcgtggggtcggaagttc 20 tRNA — Ile (ITS) (Zotov et al., 2013) for the genus Rhizobium
Ala gctctcccagctgagcta 18 tRNA — Ala (ITS) (Zotov et al., 2013) for the genus Rhizobium
Ala-R ctctcccagctgagctacag 20 tRNA — Ala (ITS) (Zotov et al., 2013) for the genus Rhizobium
hinF+R SEQ ID №1+SEQ ID №2   hin-region, 3′-end of 1st tRNA (Glu) — 5′-end 3rd tRNA (Glu) (Zotov et al., 2013) Xanthomonas spp., RosPatent № 2011135461 from 25.08.2011
rhiF+R SEQ ID №3+SEQ ID №4   hin-region,3′-end of 1st tRNA (Glu) —5′-end 2nd or 3rd tRNA (Glu) (Zotov et al., 2013), (Punina et al., 2013) Rhizobium spp., RosPatent № 2011135461 from 25.08.2011
FGPD807 cactgctaccggtcgatgaa 20 nifD-K (Laguerre et al., 1996) for R. leguminosarum bv. viciae, trifolii, phaseoli; use with FGPK492′
FGPK492′ gatgacctcggccat 15 nifD-K (Laguerre et al., 1996) for R. leguminosarum bv. viciae, trifolii, phaseoli;use with FGPD807
nifHF tacggnaarggsggnatcggcaa 23 nifH (Laguerre et al., 2001) universal for rhizobia; use with nifHI primer
nifHI agcatgtcytcsagytcntcca 22 nifH (Laguerre et al., 2001) universal for rhizobia; use with nifHF primer
NBA12 ggatsgcaatcatctayrgmrtgg 24 nodD + nodD-nodF (Laguerre et al., 1996) for R. leguminosarum bv. viciae, trifolii; use with NBF12′
NBF12′ ggatcraaagcatccrcastatgg 24 (Laguerre et al., 1996) for R. leguminosarum bv. viciae, trifolii; use with NBA12
nodCI` cghgacagccartcrctrttg 21 nodC (Laguerre et al., 2001) universal for rhizobia; use with nodCF` primer
nodCF` aygtngtygaygayggttc 19 nodC (Laguerre et al., 2001) universal for rhizobia; use with nodCI` primer
NODD2PH678 tgagttgcaagggccttgatc 21 nodD2 (Laguerre et al., 1996) for R. leguminosarum bv. phaseoli; use with NODD3PH2152′, or NODDRL2′ primer
NODD3PH2152′ agatgactgcgcccccgatag 21 nodD2 + nodD2-nodD3 (Laguerre et al., 1996) for R. leguminosarum bv. phaseoli; use with NODD2PH678 primer
NODDRL2′ ctcgcgcatccakatgtttcc 21 nodD/nodD2 (Laguerre et al., 1996) for R. leguminosarum bv. viciae, trifolii, phaseoli; use with NODD2PH678 primer
Pr. CTAG-2 gaggccgtggttttagctag 20 saAFLP (Zotov et al., 2013) universal
Pr. CTAG1 ctggaatcgattccagctag 20 saAFLP (Zotov et al., 2012) universal
Pr. cons-2 gaggccgtggttttag 16 saAFLP (Zotov et al., 2013) universal
Pr. cons-2rev ctaaaaccacggcctc 16 saAFLP (Zotov et al., 2013) universal
Ad. CTAG1 ctagctggaatcgattccag 20 saAFLP (Zotov et al., 2012) universal
Ad. CTAG-2 ctagctaaaaccacggcctc 20 saAFLP (Zotov et al., 2013) this adapter works along with the Ad. CTAG1
ERIC 1R atgtaagctcctggggattcac 22 enterobacterial repetitive intergenic consensus (ERIC) (Versalovic et al., 1991) for Xanthomonas spp. (Louws et al., 1994): 1 initial cycle at 95°C for 7 min; 30 cycles of denaturation at 94°C for 1 min, annealing at 44°, 52°, or 53°C for 1 min with REP, ERIC, and BOX primers, respectively, and extension at 65°C for 8 min with a single final extension cycle at 65°C for 15 min and a final cycle at 4°C.
ERIC 2 aagtaagtgactggggtgagcg 22 enterobacterial repetitive intergenic consensus (ERIC) (Versalovic et al., 1991)
BOX A1R ctacggcaaggcgacgctgacg 22 BOX elements (Martin et al., 1992)
REP1R-I iiiicgicgicatciggc 18 repetitive extragenic palindromic (REP) (Versalovic et al., 1991)
REP2-I icgicttatciggcctac 18 repetitive extragenic palindromic (REP) (Versalovic et al., 1991)
Box_S3 ggcgacgctgacg 13 BOX elements (Zotov et al., 2010) for rape Xanthomonas spp.! 1 cycle: 94°С — 2`; 35 cycles: 94°C -30«, 50°C — 30«, 72°C — 1.5`; 1 cycle: 72°C — 5`.
UP1 gaagtcatcatgaccgttctgcaygcnggnggnaarttyga 41 gyrB (Yamamoto and Harayama, 1995) universal
UP2r agcagggtacggatgtgcgagccrtcnacrtcngcrtcngtca 43 gyrB (Yamamoto and Harayama, 1995) universal
BT_gyrB_F cttgaaggactagargcagt 20 gyrB (Punina et al., 2013) for Bacillus cereus group
BT_gyrB_Fr ggtgargatgttcgtgaagg 20 gyrB (Punina et al., 2013) for Bacillus cereus group
BT_gyrB_Rf ccttcacgaacatcytcacc 20 gyrB (Punina et al., 2013) for Bacillus cereus group
BT_gyrB_R tggataaagttacgacgygg 20 gyrB (Punina et al., 2013) for Bacillus cereus group
Rh_gyrB_R tcgcgccgcggctcgacttcrtcncccatca 31 gyrB (Zotov et al., 2013) for genus Rhizobium
Rh_gyrB_F1 gacggaaaacggcgtaagcaccgaatatgg 30 gyrB (Zotov et al., 2013) for genus Rhizobium
Rh_gyrB_F2 ggcacvcayatggcnggyttccg 23 gyrB (Zotov et al., 2013) for genus Rhizobium
Rh_gyrB_F3 ctctataaggtckcgcgcggcaagtcggtgcagt 34 gyrB (Zotov et al., 2013) for genus Rhizobium
M13DirL gttgtaaaacgacggccagtg 21 cloning, plasmid sequencing   universal
M13Rev(-48) agcggataacaatttcacacagga 24 cloning, plasmid sequencing   universal
PRIMERS FOR PLANTS
ITS1 tccgtaggtgaacctgcgg 19 18S-5,5S-28S rRNA (ITS)-region (White et al., 1990) 3`- end of 18S rRNA
ITS2 gctgcgttcttcatcgatgc 20 18S-5,5S-28S rRNA (ITS)-region (White et al., 1990) reverse primer
ITS3 gcatcgatgaagaacgcagc 20 18S-5,5S-28S rRNA (ITS)-region (White et al., 1990) forvard primer
ITS4 tcctccgcttattgatatgc 20 18S-5,5S-28S rRNA (ITS)-region (White et al., 1990) reverse primer for 5`- end of 28S rRNA
ITS5 ggaagtaaaagtcgtaacaagg 22 18S-5,5S-28S rRNA (ITS)-region (White et al., 1990) forvard primer for 3`- end of 18S rRNA
(CA)8RG cacacacacacacacarg 18 ISSR (Svetleva et al., 2006) for Phaseolus vulgaris
(CA)7YC cacacacacacacayc 16 ISSR (Sicard et al., 2005) for Phaseolus vulgaris
(GA)7RC gagagagagagagarc 16 ISSR (Sicard et al., 2005) for Phaseolus vulgaris
(GA)8YT gagagagagagagagayt 18 ISSR (Svetleva et al., 2006) for Phaseolus vulgaris
(AG)7C agagagagagagagc 15 ISSR (Sicard et al., 2005) for Phaseolus vulgaris
(AG)8YT agagagagagagagagyt 18 ISSR (Svetleva et al., 2006) for Phaseolus vulgaris
(AG)8YC agagagagagagagagyc 18 ISSR (Svetleva et al., 2006) for Phaseolus vulgaris
(AC)8YA acacacacacacacacya 18 ISSR (Svetleva et al., 2006) for Phaseolus vulgaris
(AC)8YG acacacacacacacacyg 18 ISSR (Svetleva et al., 2006) for Phaseolus vulgaris
(GT)8YC gtgtgtgtgtgtgtgtyc 18 ISSR (Svetleva et al., 2006) for Phaseolus vulgaris
(GT)8YG gtgtgtgtgtgtgtgtyg 18 ISSR (Svetleva et al., 2006) for Phaseolus vulgaris
(AG)8YG agagagagagagagagyg 18 ISSR (Svetleva et al., 2006) for Phaseolus vulgaris
(AC)8YT acacacacacacacacyt 18 ISSR (Svetleva et al., 2006) for Phaseolus vulgaris
(GTG)4RC gtggtggtggtgrc 14 ISSR (Sicard et al., 2005) for Phaseolus vulgaris